Myotonic Dystrophy: Making an Informed Choice About Genetic Testing

Myotonic Dystrophy: Making an Informed Choice About Genetic Testing free pdf ebook was written by on December 04, 2000 consist of 20 page(s). The pdf file is provided by depts.washington.edu and available on pdfpedia since January 14, 2012.

august 2000 the development and printing of this booklet was funded by the national institute on disability and rehabilitation research, a division of the u. s ...

x
send send what is readshare?


Thank you for helping us grow by simply clicking on facebook like and google +1 button below ^^

Myotonic Dystrophy: Making an Informed Choice About Genetic Testing pdf




Read
: 827
Download
: 2
Uploaded
: January 14, 2012
Category
Author
: anonymous
Total Page(s)
: 20
Myotonic Dystrophy: Making an Informed Choice About Genetic Testing - page 1
Myotonic Dystrophy: Making an Informed Choice About Genetic Testing Written by: Corrine O’Sullivan Smith, MS, CGC Robin L. Bennett, MS, CGC Thomas D. Bird, MD Medical Genetics and Neurology University of Washington Medical Center
You're reading the first 10 out of 20 pages of this docs, please download or login to readmore.
Myotonic Dystrophy: Making an Informed Choice About Genetic Testing - page 2
August 2000 The development and printing of this booklet was funded by the National Institute on Disability and Rehabilitation Research, a division of the U. S. Department of Education, Grant # H133B980008. The authors wish to acknowledge the assistance of Hillary Lipe, ARNP in the development of this brochure. This booklet is available online through the Rehabilitation Research and Training Center in Neuromuscular diseases at UC Davis website: http://www.rehabinfo.net and the author’s website: http://depts.washington.edu/neurogen
Myotonic Dystrophy: Making an Informed Choice About Genetic Testing - page 3
Myotonic Dystrophy: Making an Informed Choice About Genetic Testing This booklet provides information about myotonic dystrophy (dystrophia myotonica or DM) and genetic testing for DM. Myotonic dystrophy is an inherited disorder of muscle function. It is characterized by muscle weakness and myotonia (slow relaxation of muscles after contraction). DM can also affect other organs of the body such as the eyes, heart and brain. Myotonic dystrophy is one of the most common forms of inherited muscle disease; it is estimated that one person in every 20,000 is affected with DM. Myotonic dystrophy is an extremely variable condition, even within families. Genetic testing is available for DM. The decision to be tested is a personal one, and each person must make his or her own informed choice about testing. SYMPTOMS OF MYOTONIC DYSTROPHY The symptoms of myotonic dystrophy vary greatly from person to person. In its most severe form, infants with DM can have extreme muscle weakness and difficulty breathing after birth. In contrast, DM can be so mild in older adults that they may not be aware they are affected until a relative with more severe symptoms comes to medical attention. Almost all affected persons have some 1
Myotonic Dystrophy: Making an Informed Choice About Genetic Testing - page 4
degree of myotonia and muscle weakness due to atrophy or shrink- age of the muscles. Myotonia is most evident in the hands, and results in difficulty releasing grip and a feeling of muscle stiffness (see Figure 1). For example, persons with DM are slow to open their hand after a handshake, or after grasping a doorknob or other object. Myotonia can be diagnosed by an electromyogram (EMG). An EMG is done by inserting fine needles into a muscle and recording electrical activity inside muscle cells. DM is de- scribed as being mild, classical or congenital based on the severity and age of onset of symptoms (See Table 1). There is an overlap of symptoms among the three descriptions of myotonic dystrophy. At this time, there is no treatment or cure that can prevent the symp- toms of myotonic dystrophy. In DM, certain muscles are more affected than others. The myotonia and muscle weakness tend to gradually worsen over a period of years (see Figure 2). The muscles of the face are often the first to show weakness, resulting in a lack of facial expression or mask-like appearance of the face (myotonic facies). Persons with DM can have slurred speech (dysarthria) and droopy eyelids (ptosis) because of weak facial muscles. The muscles of the lower leg, ankle, foot, forearm and hand are usually the next group of muscles to show weakness (distal limb muscles). This leads to A B Figure 1. A. Electromyogram (EMG) showing myotonia, the slow relaxation of a muscle after contraction. B. Grip myotonia manifested as difficulty opening the hand after making a fist 2
Myotonic Dystrophy: Making an Informed Choice About Genetic Testing - page 5
difficulty with walking, and with finger and hand movements. The muscles involved with breathing and swallowing may become weak over time. In rare instances, the muscle weakness in DM can continue to the point where an affected person has difficulty walking and needs a wheelchair. However, the extent to which weakness and myotonia will affect a person’s ability to function is variable and unpredictable. Table 1. Range of symptoms in myotonic dystrophy Description “Mild” Symptoms • Cataracts • Mild myotonia • Balding • May have diabetes • Weakness • Myotonia • Cataracts • Balding • Irregular heartbeat • May have diabetes Age of Onset or Recognition Adulthood Lifespan Normal “Classical” Childhood to May be early adulthood shortened “Congenital” • Severe weakness Birth - • Myotonia childhood • Breathing difficulties • Often mild to moderate mental retardation Shortened The majority of persons with myotonic dystrophy will eventually develop cataracts (cloudiness of the lens of the eye) that cause vision to become blurry. Cataracts are often the first recognized sign of DM. They can occur in persons without DM, especially in the elderly. In DM however, cataracts develop at a younger age, usually in the forties or fifties. Cataracts are treatable through surgery. Abnormalities of heart rhythm, called arrhythmia, are common in persons with DM. Usually this is not serious. In some cases, arrhythmia can be life threatening and cause early death. For this 3
Myotonic Dystrophy: Making an Informed Choice About Genetic Testing - page 6
hair loss cataracts of the eyes facial weakness pharynx esophagus heart abnormal rhythm trouble swallowing lung diaphragm trouble breathing gall stones testicular atrophy in males pancreas diabetes intestines constipation hand weakness and myotonic grip leg weakness Figure 2. Manifestations of myotonic dystrophy reason, persons with DM need regular monitoring of their heart rhythm through a simple test called an electrocardiogram (EKG or ECG). Some persons require medication or a pacemaker to treat an arrhythmia. Other symptoms seen in some but not all persons with DM include diabetes mellitus, gallstones, intestinal irregularity and early frontal balding. These conditions are common in people without DM as well. However, they are more frequent in myotonic dystro- phy. Men with DM can have a decrease in the size of the testes over time, but this does not usually cause infertility. 4
Myotonic Dystrophy: Making an Informed Choice About Genetic Testing - page 7
Congenital Myotonic Dystrophy Congenital DM is the most severe form of myotonic dystrophy. Congenital means “present at birth”. Symptoms may actually be detected prior to birth, and include excess amniotic fluid (polyhy- dramnios) and decreased movement of the unborn child. After birth, infants with congenital DM often have extreme muscle weakness (hypotonia) and difficulty breathing, and they may not survive past infancy. Those children that do survive can show an improvement in muscle strength. About half of all children with congenital DM have some degree of mental retardation. For reasons that are not completely understood, congenital DM almost always occurs in the child of an affected mother. Both sons and daughters of a woman with DM can be affected with congenital DM. Myotonic Dystrophy Type 2 Recently, it has been discovered that there is another type of myotonic dystrophy, called myotonic dystrophy type 2 (DM2). DM2 has also been called proximal myotonic myopathy (PROMM). The symptoms of DM2 are very similar to those of DM, and both conditions are inherited in the same way. The main difference between them is at the genetic level. The genetic change that causes DM2 is different from DM. At this time there is no genetic test for DM2. INHERITANCE OF DM Myotonic dystrophy is inherited in an autosomal dominant pattern (See Figures 3 and 4). This means each son or daughter of a person with DM has a 1 in 2, or 50% chance of inheriting the condition. Myotonic dystrophy affects males and females equally. DM is caused by a change or mutation in a specific gene, called the myotonic dystrophy protein kinase (DMPK) gene, which is essential for normal muscle and body function. Genes are the basic units of heredity, and contain the set of instructions that determine how the body grows and develops. Genes are composed of DNA (deoxyribonucleic acid). It is esti- mated that every cell in a person’s body contains between 50,000 to 100,000 genes. Genes are packaged on chromosomes - the thread- like structures within cells that are visible under a microscope (genes cannot be seen under a microscope). Each person inherits half of their chromosomes from their father, and half from their 5
Myotonic Dystrophy: Making an Informed Choice About Genetic Testing - page 8
KEY Female Male Siblings Deceased infant Clinically affected with DM Presymptomatic gene carrier of DM Figure 3. Family tree (pedigree) of a family with myotonic dystrophy showing autosomal dominant inheritance, congenital DM and a female who has tested positive for the DM gene. mother. Every person has 23 pairs of chromosomes, which contain two copies of each gene. The DMPK gene is located on chromo- some number 19. DM2 is also inherited in an autosomal dominant pattern. The gene for DM2 has not yet been found, but has been localized to chromosome number 3. The genetic change that causes DM is called a CTG repeat expansion (See Figure 4). CTG represents a specific pattern of DNA. It is normal to have between 5 to 37 CTG repeats in both copies of the DMPK gene. However, in myotonic dystrophy, the CTG pattern is repeated too many times in one copy of the DMPK gene, and disrupts the normal function of the protein made by the gene. If a person has between 38-49 repeats he or she will not Table 2. Repeat size and severity of symptoms in DM Description Normal range No symptoms (children at risk) Mild Classical Congenital 6 CTG Repeat Size 5 to 37 38 to 49 50 to about 150 about 100 to 1000-1500 about 1000 and greater
Myotonic Dystrophy: Making an Informed Choice About Genetic Testing - page 9
develop symptoms, but his or her children are at risk to inherit myotonic dystrophy. With few exceptions, individuals with 50 or more CTG repeats will develop at least mild symptoms of DM at some point in their lifetime. Genetic testing is available for DM. The genetic test measures the size of the CTG repeat in both copies of the DMPK gene. In myotonic dystrophy, there is an association between repeat size, age of symptom onset and the severity of symptoms. In general, the larger the repeat size, the younger the age at which a person will develop symptoms of DM and the more severe the symptoms will be. On the other hand, the repeat size cannot be used to predict the age when a person will develop symptoms, or the rate of symptom progression (See Table 2). The largest repeat expansions are seen in congenital DM. Anticipation Myotonic dystrophy is characterized by a phenomenon called anticipation. Anticipation refers to an earlier age of symptom onset and increasing severity of disease from one generation to the next in a family. In other words, an affected child can have more severe symptoms than the affected parent. With the recent discovery of Affected parent Unaffected parent Unaffected Unaffected Affected Affected Figure 4. Diagram of autosomal dominant inheritance. Each child has a 50% chance of inheriting DM from an affected parent. 7
Myotonic Dystrophy: Making an Informed Choice About Genetic Testing - page 10
the genetic cause of DM, the biologic basis of anticipation in this condition is beginning to be understood. It has been found that the repeat size can change when passed from parent to child. For example, if a parent has a specific repeat size on genetic testing, a child may have a larger repeat size. Anticipation cannot be pre- dicted and does not always occur. The most striking example of anticipation is seen with congeni- tal DM. For reasons that are not yet known, women with a CTG repeat expansion are at risk to have a child with congenital DM. In some cases, women have been diagnosed with mild DM during pregnancy because problems are found in an unborn child. The exact risk for a woman with DM to have a child with the severe congenital form of DM is not known. Rarely, children with congenital DM have inherited a repeat expansion from their father. Penetrance The term penetrance refers to the proportion of persons with a repeat expansion for DM who will actually develop symptoms of the condition. In DM, penetrance is very high, meaning that almost everyone with a repeat expansion of 50 or larger will develop symptoms of DM at some point in their lifetime. In some cases, a person’s symptoms can be so mild (such as cataracts in late middle age or frontal balding) that they are never diagnosed with DM. Normal CTGCTGCTGCTGCTG Expanded CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG Figure 5. Diagram of CTG repeat expansion. 8
You're reading the first 10 out of 20 pages of this docs, please download or login to readmore.

People are reading about...