Myotonic Dystrophy: Making an Informed Choice About Genetic Testing free pdf ebook was written by on December 04, 2000 consist of 20 page(s). The pdf file is provided by depts.washington.edu and available on pdfpedia since January 14, 2012.
august 2000 the development and printing of this booklet was funded by the national institute on disability and rehabilitation research, a division of the u. s ...
Myotonic Dystrophy:
Making an Informed Choice
About Genetic Testing
Written by:
Corrine O’Sullivan Smith, MS, CGC
Robin L. Bennett, MS, CGC
Thomas D. Bird, MD
Medical Genetics and Neurology
University of Washington
Medical Center
You're reading the first 10 out of 20 pages of this docs, please download or login to readmore.
August 2000
The development and printing of this booklet was funded by the
National Institute on Disability and Rehabilitation Research, a
division of the U. S. Department of Education, Grant #
H133B980008. The authors wish to acknowledge the assistance of
Hillary Lipe, ARNP in the development of this brochure.
This booklet is available online through the Rehabilitation
Research and Training Center in Neuromuscular diseases at UC
Davis website:
http://www.rehabinfo.net
and the author’s website:
http://depts.washington.edu/neurogen
Myotonic Dystrophy:
Making an Informed Choice
About Genetic Testing
This booklet provides information about myotonic dystrophy
(dystrophia myotonica or DM) and genetic testing for DM.
Myotonic dystrophy is an inherited disorder of muscle function. It
is characterized by muscle weakness and myotonia (slow relaxation
of muscles after contraction). DM can also affect other organs of
the body such as the eyes, heart and brain. Myotonic dystrophy is
one of the most common forms of inherited muscle disease; it is
estimated that one person in every 20,000 is affected with DM.
Myotonic dystrophy is an extremely variable condition, even within
families. Genetic testing is available for DM. The decision to be
tested is a personal one, and each person must make his or her own
informed choice about testing.
SYMPTOMS OF MYOTONIC DYSTROPHY
The symptoms of myotonic dystrophy vary greatly from person
to person. In its most severe form, infants with DM can have
extreme muscle weakness and difficulty breathing after birth. In
contrast, DM can be so mild in older adults that they may not be
aware they are affected until a relative with more severe symptoms
comes to medical attention. Almost all affected persons have some
1
degree of myotonia and muscle weakness due to atrophy or shrink-
age of the muscles. Myotonia is most evident in the hands, and
results in difficulty releasing grip and a feeling of muscle stiffness
(see Figure 1). For example, persons with DM are slow to open
their hand after a handshake, or after grasping a doorknob or other
object. Myotonia can be diagnosed by an electromyogram
(EMG). An EMG is done by inserting fine needles into a muscle
and recording electrical activity inside muscle cells. DM is de-
scribed as being mild, classical or congenital based on the severity
and age of onset of symptoms (See Table 1). There is an overlap of
symptoms among the three descriptions of myotonic dystrophy. At
this time, there is no treatment or cure that can prevent the symp-
toms of myotonic dystrophy.
In DM, certain muscles are more affected than others. The
myotonia and muscle weakness tend to gradually worsen over a
period of years (see Figure 2). The muscles of the face are often the
first to show weakness, resulting in a lack of facial expression or
mask-like appearance of the face (myotonic facies). Persons with
DM can have slurred speech (dysarthria) and droopy eyelids
(ptosis) because of weak facial muscles. The muscles of the lower
leg, ankle, foot, forearm and hand are usually the next group of
muscles to show weakness (distal limb muscles). This leads to
A
B
Figure 1. A. Electromyogram (EMG) showing myotonia, the
slow relaxation of a muscle after contraction.
B. Grip myotonia manifested as difficulty opening
the hand after making a fist
2
difficulty with walking, and with finger and hand movements. The
muscles involved with breathing and swallowing may become weak
over time. In rare instances, the muscle weakness in DM can
continue to the point where an affected person has difficulty
walking and needs a wheelchair. However, the extent to which
weakness and myotonia will affect a person’s ability to function is
variable and unpredictable.
Table 1. Range of symptoms in myotonic dystrophy
Description
“Mild”
Symptoms
• Cataracts
• Mild myotonia
• Balding
• May have diabetes
• Weakness
• Myotonia
• Cataracts
• Balding
• Irregular heartbeat
• May have diabetes
Age of Onset
or Recognition
Adulthood
Lifespan
Normal
“Classical”
Childhood to
May be
early adulthood shortened
“Congenital” • Severe weakness
Birth -
• Myotonia
childhood
• Breathing difficulties
• Often mild to
moderate mental
retardation
Shortened
The majority of persons with myotonic dystrophy will eventually
develop cataracts (cloudiness of the lens of the eye) that cause vision
to become blurry. Cataracts are often the first recognized sign of
DM. They can occur in persons without DM, especially in the
elderly. In DM however, cataracts develop at a younger age, usually
in the forties or fifties. Cataracts are treatable through surgery.
Abnormalities of heart rhythm, called arrhythmia, are common
in persons with DM. Usually this is not serious. In some cases,
arrhythmia can be life threatening and cause early death. For this
3
hair loss
cataracts
of the eyes
facial weakness
pharynx
esophagus
heart
abnormal rhythm
trouble swallowing
lung
diaphragm
trouble breathing
gall stones
testicular
atrophy
in males
pancreas
diabetes
intestines
constipation
hand
weakness
and
myotonic grip
leg weakness
Figure 2. Manifestations of myotonic dystrophy
reason, persons with DM need regular monitoring of their heart
rhythm through a simple test called an electrocardiogram (EKG or
ECG). Some persons require medication or a pacemaker to treat an
arrhythmia.
Other symptoms seen in some but not all persons with DM
include diabetes mellitus, gallstones, intestinal irregularity and early
frontal balding. These conditions are common in people without
DM as well. However, they are more frequent in myotonic dystro-
phy. Men with DM can have a decrease in the size of the testes over
time, but this does not usually cause infertility.
4
Congenital Myotonic Dystrophy
Congenital DM is the most severe form of myotonic dystrophy.
Congenital means “present at birth”. Symptoms may actually be
detected prior to birth, and include excess amniotic fluid (polyhy-
dramnios) and decreased movement of the unborn child. After
birth, infants with congenital DM often have extreme muscle
weakness (hypotonia) and difficulty breathing, and they may not
survive past infancy. Those children that do survive can show an
improvement in muscle strength. About half of all children with
congenital DM have some degree of mental retardation. For reasons
that are not completely understood, congenital DM almost always
occurs in the child of an affected mother. Both sons and daughters
of a woman with DM can be affected with congenital DM.
Myotonic Dystrophy Type 2
Recently, it has been discovered that there is another type of
myotonic dystrophy, called myotonic dystrophy type 2 (DM2).
DM2 has also been called proximal myotonic myopathy
(PROMM). The symptoms of DM2 are very similar to those of
DM, and both conditions are inherited in the same way. The main
difference between them is at the genetic level. The genetic change
that causes DM2 is different from DM. At this time there is no
genetic test for DM2.
INHERITANCE OF DM
Myotonic dystrophy is inherited in an autosomal dominant
pattern (See Figures 3 and 4). This means each son or daughter of a
person with DM has a 1 in 2, or 50% chance of inheriting the
condition. Myotonic dystrophy affects males and females equally.
DM is caused by a change or mutation in a specific gene, called the
myotonic dystrophy protein kinase (DMPK) gene, which is
essential for normal muscle and body function.
Genes are the basic units of heredity, and contain the set of
instructions that determine how the body grows and develops.
Genes are composed of DNA (deoxyribonucleic acid). It is esti-
mated that every cell in a person’s body contains between 50,000 to
100,000 genes. Genes are packaged on chromosomes - the thread-
like structures within cells that are visible under a microscope
(genes cannot be seen under a microscope). Each person inherits
half of their chromosomes from their father, and half from their
5
KEY
Female
Male
Siblings
Deceased
infant
Clinically affected
with DM
Presymptomatic
gene carrier of DM
Figure 3. Family tree (pedigree) of a family with myotonic dystrophy showing
autosomal dominant inheritance, congenital DM and a female who has tested
positive for the DM gene.
mother. Every person has 23 pairs of chromosomes, which contain
two copies of each gene. The DMPK gene is located on chromo-
some number 19.
DM2 is also inherited in an autosomal dominant pattern. The
gene for DM2 has not yet been found, but has been localized to
chromosome number 3.
The genetic change that causes DM is called a CTG repeat
expansion (See Figure 4). CTG represents a specific pattern of
DNA. It is normal to have between 5 to 37 CTG repeats in both
copies of the DMPK gene. However, in myotonic dystrophy, the
CTG pattern is repeated too many times in one copy of the DMPK
gene, and disrupts the normal function of the protein made by the
gene. If a person has between 38-49 repeats he or she will not
Table 2. Repeat size and severity of symptoms in DM
Description
Normal range
No symptoms
(children at risk)
Mild
Classical
Congenital
6
CTG Repeat Size
5 to 37
38 to 49
50 to about 150
about 100 to 1000-1500
about 1000 and greater
develop symptoms, but his or her children are at risk to inherit
myotonic dystrophy. With few exceptions, individuals with 50 or
more CTG repeats will develop at least mild symptoms of DM at
some point in their lifetime.
Genetic testing is available for DM. The genetic test measures
the size of the CTG repeat in both copies of the DMPK gene. In
myotonic dystrophy, there is an association between repeat size, age
of symptom onset and the severity of symptoms. In general, the
larger the repeat size, the younger the age at which a person will
develop symptoms of DM and the more severe the symptoms will
be. On the other hand, the repeat size cannot be used to predict the
age when a person will develop symptoms, or the rate of symptom
progression (See Table 2). The largest repeat expansions are seen in
congenital DM.
Anticipation
Myotonic dystrophy is characterized by a phenomenon called
anticipation. Anticipation refers to an earlier age of symptom onset
and increasing severity of disease from one generation to the next in
a family. In other words, an affected child can have more severe
symptoms than the affected parent. With the recent discovery of
Affected
parent
Unaffected
parent
Unaffected
Unaffected
Affected
Affected
Figure 4. Diagram of autosomal dominant inheritance. Each child has a 50%
chance of inheriting DM from an affected parent.
7
the genetic cause of DM, the biologic basis of anticipation in this
condition is beginning to be understood. It has been found that the
repeat size can change when passed from parent to child. For
example, if a parent has a specific repeat size on genetic testing, a
child may have a larger repeat size. Anticipation cannot be pre-
dicted and does not always occur.
The most striking example of anticipation is seen with congeni-
tal DM. For reasons that are not yet known, women with a CTG
repeat expansion are at risk to have a child with congenital DM.
In some cases, women have been diagnosed with mild DM during
pregnancy because problems are found in an unborn child.
The exact risk for a woman with DM to have a child with the
severe congenital form of DM is not known. Rarely, children with
congenital DM have inherited a repeat expansion from their father.
Penetrance
The term penetrance refers to the proportion of persons with a
repeat expansion for DM who will actually develop symptoms of
the condition. In DM, penetrance is very high, meaning that
almost everyone with a repeat expansion of 50 or larger will develop
symptoms of DM at some point in their lifetime. In some cases, a
person’s symptoms can be so mild (such as cataracts in late middle
age or frontal balding) that they are never diagnosed with DM.
Normal
CTGCTGCTGCTGCTG
Expanded
CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG
Figure 5. Diagram of CTG repeat expansion.
8
You're reading the first 10 out of 20 pages of this docs, please download or login to readmore.
